Hydrogenophilus thermoluteolus
WebGenome browser: NT seq: 1473 nt NT seq +upstream nt +downstream nt atgaacgagacgcagatgaaacacctcagctggtcggtcaacgagcgcggtattgcgtgg ... Web1 mrt. 2010 · Based on its physiological and molecular properties, it is concluded that strain 16C (T) represents a novel species within the genus Hydrogenophilus, for which the name Hydrogenophilus...
Hydrogenophilus thermoluteolus
Did you know?
WebOhkubo Tadayasu Professor. The laboratory of biophysical chemistry aims to determine three-dimensional structures of proteins and their complexes in order to obtain novel … WebHydrogenophilus thermoluteolus TH-1: Category: Type strain: Annotation: yes: Taxonomy: TAX: 297: Lineage: Bacteria; Pseudomonadota; Hydrogenophilia; Hydrogenophilales; …
WebGlyoxylate and dicarboxylate metabolism - Hydrogenophilus thermoluteolus [ Pathway menu Organism menu Pathway entry Download Help] Option. Scale: 100%. Image resolution: High Search. ID search Color Module. Pathway modules Carbohydrate metabolism Other carbohydrate ... WebRecent crystallographic studies of the enzyme from Hydrogenophilus thermoluteolus TH-1 in the oxidized state revealed a unique six-coordinated Ni with three bridging cysteine thiolate ligands, one terminal cysteine sulfur, and bidentate ligation of the glutamine side chain. 49,98,99 Three bridging thiol ligands between the metals (both octahedral …
Web5 83 The genus Hydrogenophilus currently harbors the species H. thermoluteolus, H. hirschii 84 and H. islandicus (Hayashi et al., 1999; Stöhr et al., 2001; Vésteinsdóttir et al., … Web7 mei 2011 · The numbering on the Hydrogenophilus thermoluteolus cytochrome c ′ (PHCP) sequence is that of the mature protein. The sequence of PHCP was chemically determined up to the 30th residue in this study and confirmed by the protein sequence deduced from the cloned gene.
WebHydrogenophilus thermoluteolus: HPTL_0624: Help: Entry: HPTL_0624 CDS T05630 : Name (GenBank) 3-hydroxyacyl-CoA dehydrogenase. Organism: htl Hydrogenophilus thermoluteolus. SSDB: Ortholog Paralog Gene cluster GFIT: Motif: Pfam: adh_short adh_short_C2 KR Epimerase ADH_zinc_N ATPgrasp_N DFP: Motif: Other DBs ...
Webhtl Hydrogenophilus thermoluteolus Pathway htl00010 Glycolysis / Gluconeogenesis htl00020 Citrate cycle (TCA cycle) htl00620 Pyruvate metabolism htl01100 Metabolic pathways htl01110 Biosynthesis of secondary metabolites htl01120 Microbial metabolism in diverse environments htl01200 Carbon metabolism Module htl_M00307 helm nolan n87Web1 apr. 1999 · Hydrogenophilus thermoluteolus gen. nov., sp. nov., a thermophilic, facultatively chemolithoautotrophic, hydrogen-oxidizing bacterium Nobuhiro R. Hayashi … helm njs kairosWeb1 dec. 2024 · The mol% G + C of the DNA is: 61–65. Type species: Hydrogenophilus thermoluteolus Hayashi, Ishida, Yokota, Kodama and Igarashi 1999, 785. Read more. … helm mysql 集群Web1 jan. 2024 · and genomic DNA from Hydrogenophilus thermoluteolus TH-1 T as the template. The underlined bases of the primers are complementary to plasmid pGE837, … helm mysql 8Web1 feb. 2011 · Hydrogenophilus islandicus sp. nov., a thermophilic hydrogen-oxidizing bacterium isolated from an Icelandic hot spring Microbiology Society Volume 61, Issue 2 Other Free Hydrogenophilus islandicus sp. nov., a thermophilic hydrogen-oxidizing bacterium isolated from an Icelandic hot spring helm nhk xinoidhttp://smart.embl.de/smart/do_annotation.pl?DOMAIN=SM00886 helm ninjaWebName: Hydrogenophilus thermoluteolus Hayashi et al. 1999 Category: Species Proposed as: sp. nov. Etymology: ther.mo.lu.te’o.lus. Gr. masc. adj. thermos, hot; L. masc. adj. … helm mysql集群